• Hey Guest. Check out your NeoGAF Wrapped 2025 results here!

The Trials HD Official Thread

nocode said:
Does anyone remember when most games were this hard? I can't be the only one. I remember playing C64 games for days and days trying to beat them, only to realize eventually that there was no ending. :lol :lol
Click to expand...

anibrucebigfight1.gif
 
well well well. if it isnt the thread for the best game on XBLA. with new content!!! fuck yes.

good to see some activity in this thread. keep at it new guys! this is one of the most rewarding games ever.

one of all time favorite games right here. so damn good. (i havent played in weeks! damn. i gotta get back)
 
Rather than a completely new game, I'd rather have some kind of open level sharing. If they were to develop a full fledged sequel though, the only real addition that I can think of is some more variety in environments. This game is pretty much perfect for what it is already.
 
I have a love/hate relationship game and I'm just referring to the difficulty. I decided to play a course before bed and 40 secs in Elite red ringed on me. >:o
 
Oh Jesus I'm posting on the wrong thread :D Anyways, I love Trials! Unfortunately my global ranking is threatening to fall below 500. =/
 
Popeck said:
Oh Jesus I'm posting on the wrong thread :D Anyways, I love Trials! Unfortunately my global ranking is threatening to fall below 500. =/
Click to expand...

oh boo fucking hoo. poooor you! :p

get racin' fool. (ive only cracked the top 3000)
 
Just got this game plus the expansion pack.

Sooooooo fucking good. Difficulty is perfect so far. I'm on the medium tracks now. I'm sorry I waited so long to get this game.
 
Shick Brithouse said:
Just got this game plus the expansion pack.

Sooooooo fucking good. Difficulty is perfect so far. I'm on the medium tracks now. I'm sorry I waited so long to get this game.
Click to expand...

Just promise that when you hit the wall, and you will, that you keep going until you break through it. Hard will start to kick your ass, but that's part of the fun.
 
At first Extreme will feel literally impossible. In time, they will be the most fun to run.

The first two times I attempted Inferno 2, I failed out after 30 minutes and hundreds of faults. Now, I can get it in 5 faults and under 2 minutes. :D

Same with Going Up. There's a big wooden box I used to hit 30 minutes on. Now I can hop right over it.

I honestly think it's the best 360 game ever.
 
Shick Brithouse said:
Just got this game plus the expansion pack.

Sooooooo fucking good. Difficulty is perfect so far. I'm on the medium tracks now. I'm sorry I waited so long to get this game.
Click to expand...
You will hit a brick wall at some point, but just keep trying. It's worth it. If you find yourself too frustrated, just play some skill games.
 
BolognaSoup said:
At first Extreme will feel literally impossible. In time, they will be the most fun to run.

The first two times I attempted Inferno 2, I failed out after 30 minutes and hundreds of faults. Now, I can get it in 5 faults and under 2 minutes. :D

Same with Going Up. There's a big wooden box I used to hit 30 minutes on. Now I can hop right over it.

I honestly think it's the best 360 game ever.
Click to expand...
Yup, I remember getting 300 faults or something on Inferno 2.

Now I'm ranked about 780 on Inferno 2 with 0 faults and 1:14. I LOVE this game. I'm ranked 799 on the Global leaderboard, and 970 or something for the global leaderboard with DLC.

My best track is The DLC version of In Flames. I'm ranked something like 158. I really want to get sub 100 on that track.

WHEN IS THE NEW DLC COMING OUT!
 
Anyone else extremely competitive with this game? I've been playing it so much this past month and I've improved a crazy amount. A month or so ago I was ranked 1300, now I'm ranked 399 for global leaderboard+dlc.

I'm destroying this game. I'm ranked 800 for Inferno 2, 250 for Trials/tribulations, 180 for the DLC version of In Flames. So awesome.
 
I was ranked 980 or so global (not incl dlc) but sort of dropped off. You sound like a machine whitehawk haha.

Everytime I see this thread come up in my subscriptions I get all excited because I think it'll be for a new DLC announcement :(
 
I came across this code that was on a bunch of signs in a secret area in Trials HD. Specifically the Prison level's secret area.
After you jump through the bunk bed, you need to hop up onto the lights above the picnic area. Once you jump to the second light, an object in the background will fall signaling you have opened the trap door. Then back off the light to the picnic table below and behind you. After this, roll back into the opening in th floor. At the end of the tunnel are several signs on the wall and floor with the following on them right before an atom bomb that resets you. All signs had the same series of letters.

I'm posting this in both the trials forum and off topic forum because it will see more traffic there. Google brought up nothing.

The string of letters:

ccggccagcggccgggctccccagccacgcccctgcacct

They were all caps as well.

Any ideas as to what they mean?

EDIT: I got some help in the off topic forum. It is a sequence of DNA. Thanks Cyan and Mudkips.
 
Anyone know when the new DLC is coming out? I've hit a wall and I think think I can rank up much more now. I just hit rank 149 on Inferno 2, with a time of 1:00. I need new tracks!!

Also, two DLC packs in a 1.5 years seems pretty lame... I think they easily could have fit 3 DLC packs in that time period.
 
whitehawk said:
Anyone know when the new DLC is coming out? I've hit a wall and I think think I can rank up much more now. I just hit rank 149 on Inferno 2, with a time of 1:00. I need new tracks!!

Also, two DLC packs in a 1.5 years seems pretty lame... I think they easily could have fit 3 DLC packs in that time period.
Click to expand...

nice time. Congrats.
 
Trials HD - Big Thrills is scheduled to race onto fine dashboards everywhere on December 1, 2010, available for 400 Microsoft Points.
 
The second one posted is just awesome aesthetically, they did a great job masking the decor. All of them are great, can't wait for 12/1.
 
posted on facebook this morning

Surprise, Trials fans! Today we're giving away Trials Legends, a new, free PC game that recaptures the classic gameplay of the original web and PC-based Trials experience from 2000 to 2005. A link to the download is attached, available to all fans of this page. Share with a friend!
http://www.redlynxtrials.com/trialslegends/

103mb
 
So I've been trying to buy this on XBL and I keep getting the same error code...looks like a few other people on various forums are having this problem too, no idea what the deal is. :(
 
Prodigal said:
So I've been trying to buy this on XBL and I keep getting the same error code...looks like a few other people on various forums are having this problem too, no idea what the deal is. :(
Click to expand...

Grrr still can't buy it
 
Got this when it was on sale, so much stupid pointless fun jumping smoothly over massive gapes and doing really slow back flips :lol I wish I had an endless map full of jumps to mess about with.
 
Just a reminder everyone. The DLC will be out very shortly. In about 5 hours

Really want to stay up to buy it then, but luckily I'm not that stupid.
 
I picked up Trials HD during the last sale and I have a question about user created maps. When I go to the custom maps section, it says none of my friends have any custom maps to download. Is there any way to play maps from other people, or can I only play maps that people on my friends list have created?
 
You must log in or register to reply here.

Similar threads

Crown's Trial - Official Announcement Trailer
Trailer Indie 
2
121
March Climber replied
$1000 console? I'm out. official boycott thread
3 4 5 6 7
323
3K
Sethbacca replied
Legend and Trials of Mana get GOG releases
News 
4
183
John Bilbo replied
The Skin Stapler - Official Trailer
Retro Indie 
0
90
roosnam1980 replied
Legend of Mana & Trials of Mana Remake launch on GOG under the GOG Preservation Program
News 
16
435
Northeastmonk replied
Top Bottom